View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16600_high_34 (Length: 275)
Name: NF16600_high_34
Description: NF16600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16600_high_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 14 - 259
Target Start/End: Original strand, 43163555 - 43163800
Alignment:
| Q |
14 |
gaaatgaatacccaaaccacaccaatggaggtcttacccgaatatgatgtctttattcacacttctgatggcacacgcattccagcccacacaaccatcc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43163555 |
gaaatgaatacccaaaccacaccaatggaggtcttacccgaatatgatgtctttattcacacttctgatggcacacgcattccagcccacacaaccatcc |
43163654 |
T |
 |
| Q |
114 |
tggttagtttgtctccaattctttgtcattttannnnnnnaattcgatatccaattcaaggactaacgattattgtaaatcaataattaacaggcctcgg |
213 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43163655 |
tggttagtttgtctccaattcttcgtcattttatttttttaattcggtatccgattcaaggactaacgattattgtaaatcaataattaacaggcctcgg |
43163754 |
T |
 |
| Q |
214 |
tgtctcctgttttcgagaacattattgatcaaccgcgcaaacaacg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43163755 |
tgtctcctgttttcgagaacattattgatcaaccgcgcaaacaacg |
43163800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University