View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16600_high_38 (Length: 253)
Name: NF16600_high_38
Description: NF16600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16600_high_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 15 - 237
Target Start/End: Original strand, 4184602 - 4184818
Alignment:
| Q |
15 |
attatacttgatgttatgtgtaactttcttcttcatattggaaccattatatatttgtgttgggaaaaattgatggtttctttagagagaagtacgctcc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || | ||||||| ||||||||||||||| || |||||| |
|
|
| T |
4184602 |
attatacttgatgttatgtgtaactttcttcttcatattggaaccattatatatgtgttttag--aaaattg---gtttctttagagagatgtgcgctcc |
4184696 |
T |
 |
| Q |
115 |
cagcacaattcattgtctaacttccaccatcaatgggttcatatgtgatttatcttaggtcatttctagaatcaaagaaacaactagaattgatcccttc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4184697 |
-agcacaattcattgtctaacttccaccatcaatgggttcatatgtgatttatcttaggtcatttctagaatcaaagaaacaactagaattgatcccttc |
4184795 |
T |
 |
| Q |
215 |
ttagagaggtctgaagccatata |
237 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
4184796 |
ttagagaggtctgaagccatata |
4184818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University