View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16600_low_37 (Length: 293)
Name: NF16600_low_37
Description: NF16600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16600_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 68 - 277
Target Start/End: Complemental strand, 37421267 - 37421058
Alignment:
| Q |
68 |
gtaaatcttaaaagtatccaaaatattgacagaatatcttgtacatatcccgatacatctgcattagtgttcgtgcgcttagaactggagctagggtttc |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37421267 |
gtaaatcttaaaagtatccaaaatattgacagaatatcttgtacatatcccgatacatctgcattagtgttcgtgcgcttagaactggagctagggtttc |
37421168 |
T |
 |
| Q |
168 |
aaactctcaccaaaaacaagcaccatagcttccttctcttccaccggcgtagaacttccgtcgtaaagcgtcgttcacactaaacccatcacgaagctct |
267 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37421167 |
aaactctcaccgaaaacaagcaccatagcttccttctcttccaccggcgtagaacttacgtcgtaaagcgtcgttcacactaaacccatcacgaagctct |
37421068 |
T |
 |
| Q |
268 |
atccatctcc |
277 |
Q |
| |
|
|||||||||| |
|
|
| T |
37421067 |
atccatctcc |
37421058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University