View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16600_low_47 (Length: 235)
Name: NF16600_low_47
Description: NF16600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16600_low_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 46 - 153
Target Start/End: Complemental strand, 762187 - 762080
Alignment:
| Q |
46 |
gtgacatctgaaggtgcttcttagcaaattagtatcattggagattatgaatttccagggttattaaatatttaacttcacaaaatatataactctgatt |
145 |
Q |
| |
|
|||||||||||||||||||||| || | |||||||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
762187 |
gtgacatctgaaggtgcttcttgatgaagttgtatcattggagattatgaatttccaaggttatttaatatttaacttaacaaaatatataactctgatt |
762088 |
T |
|
| Q |
146 |
tttaatat |
153 |
Q |
| |
|
|||||||| |
|
|
| T |
762087 |
tttaatat |
762080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 28 - 69
Target Start/End: Original strand, 793657 - 793698
Alignment:
| Q |
28 |
tctgatgagggcaggtgagtgacatctgaaggtgcttcttag |
69 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
793657 |
tctgttgaggacaggtgagtgacatctgaaggtgcttcttag |
793698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University