View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16600_low_53 (Length: 216)
Name: NF16600_low_53
Description: NF16600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16600_low_53 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 11 - 183
Target Start/End: Original strand, 7733540 - 7733712
Alignment:
| Q |
11 |
tgagatgaaattgatatgtccctaccattcaaattgcttgaagaggttgaggtcttttcttctaccttcttagaagtgctgctctgaagaggtgttcttt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7733540 |
tgagatgaaattgatatgtccctaccattcaaattgcttgaagaggttgaggtcttttcttctaccttcttagaagtgctgctctgaagaggtgttcttt |
7733639 |
T |
|
| Q |
111 |
ccaaaggcaactgagaggaactcttgagattgtgattaagaacattatcaattcttcccacatcattacctcc |
183 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7733640 |
ccaacggcaactgagaggaactcttgagattgtgattaagaacattatcaattcttcccacatcatttcctcc |
7733712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 175 - 206
Target Start/End: Complemental strand, 7733764 - 7733733
Alignment:
| Q |
175 |
attacctcctgacatggatcctattgatgatg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7733764 |
attacctcctgacatggatcctattgatgatg |
7733733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University