View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16600_low_55 (Length: 203)
Name: NF16600_low_55
Description: NF16600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16600_low_55 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 13 - 188
Target Start/End: Complemental strand, 40539420 - 40539245
Alignment:
| Q |
13 |
gagatgaacaaagtaattcggttgcttcttgttctgatgaattgagtagaagggctgaagatttcattgcaagagtaaataggcataggaaactagaact |
112 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40539420 |
gagatgaacaaagtaattcggttgcttttcgttctgatgaattgagtagaagggctgaagatttcattgcaagagtaaataggcataggaaactagaact |
40539321 |
T |
 |
| Q |
113 |
tagtcgtttgcaaaatggttgttactagactaataatagtgtagtgaagggtgcatgagttttccatctataatgt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40539320 |
tagtcgtttgcaaaatggttgttactagactaataatagtgtagtgaagggtgcatgagttttccatctataatgt |
40539245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University