View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16602_low_4 (Length: 261)
Name: NF16602_low_4
Description: NF16602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16602_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 19 - 244
Target Start/End: Complemental strand, 2152778 - 2152554
Alignment:
| Q |
19 |
gactagtatggtgatgactgaccactacctataacgttacacttacagttggacagctagagtgtgatccgtgtgacccaatagcggtgacctagcaggt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || |||| | || |||||||||||| ||||| |||| |||||||||||||||||||||||| |
|
|
| T |
2152778 |
gactagtatggtgatgactgaccactacctataacgtcacgcttagaattagacagctagagtctgatcgatgtggcccaatagcggtgacctagcaggt |
2152679 |
T |
 |
| Q |
119 |
ggcctaacaaaccttggatagactagtatatcatcttaggatttgggttaatcctaattcaagtcctacaaaatcgacttagtaaggtggagactgtcca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |||||||||| ||||||| |||||||||| |
|
|
| T |
2152678 |
ggcctaacaaaccttggatagactagtataccatcttagaatttgggttaatcctaattcaagtcctacgaaatcgactt-ttaaggtgaagactgtcca |
2152580 |
T |
 |
| Q |
219 |
ccaattattaacatgcacgttttcaa |
244 |
Q |
| |
|
||| |||||||||| ||||||||||| |
|
|
| T |
2152579 |
ccacttattaacatacacgttttcaa |
2152554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University