View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16602_low_6 (Length: 230)
Name: NF16602_low_6
Description: NF16602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16602_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 7 - 212
Target Start/End: Original strand, 5957666 - 5957871
Alignment:
| Q |
7 |
ggaggagcacagagggagtttctacctacggtgcgtgtgcacgagtttccaatggacccagatatatacaccgaatggaagatgttacaatggaagccgc |
106 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5957666 |
ggagcagcacagagggagtttctacctacggtgcgtgtgcaggagtttccaatggacccagatatatacacagaatggaagatgttacaatggaagccgc |
5957765 |
T |
 |
| Q |
107 |
cggagtttgcgcgagcacctggtgggccaccgtcgaatgtggcggtggcccatgtcaggcttggcggacgggcggctttgttggggaaagttggggagga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5957766 |
cggagtttgcgcgagcacctggtgggccgccgtcgaatgtggcggtggcccatgtcaggcttggcggacgggcggctttgttggggaaagttggggagga |
5957865 |
T |
 |
| Q |
207 |
tgagtt |
212 |
Q |
| |
|
|||||| |
|
|
| T |
5957866 |
tgagtt |
5957871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University