View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16602_low_9 (Length: 213)
Name: NF16602_low_9
Description: NF16602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16602_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 38 - 150
Target Start/End: Complemental strand, 44656222 - 44656110
Alignment:
| Q |
38 |
tcaaagaacaagcattatgcataaagcgaagccgaatgagatgtttaaaagggaacagtttaattataactctatgggtgggcaaacgaagaagactaca |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44656222 |
tcaaagaacaagcattatgcataaagcgaagccgaatgagatgtttaaaagggaacagtttaattataactctatgggtaggcaaacgaagaagactaca |
44656123 |
T |
 |
| Q |
138 |
aacaatagggaat |
150 |
Q |
| |
|
||||||||||||| |
|
|
| T |
44656122 |
aacaatagggaat |
44656110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University