View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16604_high_21 (Length: 309)
Name: NF16604_high_21
Description: NF16604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16604_high_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 20 - 295
Target Start/End: Original strand, 25777972 - 25778247
Alignment:
| Q |
20 |
cctctttgtgatattgaggtgggagggatatttggtttacacaaagcgttagaataggttttagaccatcagtttgacaacgtagattttgctctagact |
119 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
25777972 |
cctctttgtgatatcgaggtgggagggatatttggtttacacaaagcgttagaataggttttagaccatcagttcgacaatgtagattttgctctagact |
25778071 |
T |
 |
| Q |
120 |
gtaagatcatttatcaatttagaacattgtgtatttcgttgtattatatctaccggtaaacaattgttacatgatagttttcagaactttaaagttgaga |
219 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25778072 |
gtaagatcatttatcaatttagaacgttgtgtatttcgttgtattatatctaccgataaacaattgttacatgatagttttcataactttaaagttgaga |
25778171 |
T |
 |
| Q |
220 |
tcaataggaggaaaactaatgaggttcctcacgaattaacacataaccccatataatgctaacacacatatttaga |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25778172 |
tcaataggaggaaaactaatgaggttcctcacgaattaacacataaccccatataatgctaacacacatatttaga |
25778247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University