View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16604_low_13 (Length: 372)
Name: NF16604_low_13
Description: NF16604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16604_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 131 - 358
Target Start/End: Complemental strand, 31209189 - 31208963
Alignment:
| Q |
131 |
aacaatttcttaagccaaaattttcacgagaataattaagcttgaaattatctttctctttaaattaaattttggttatgcatctagtggtgaatttctt |
230 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
31209189 |
aacaatttcttaagccaaaactttcacgagaataattaagcttgaaattatctttctctttaaattaaattttggttatgcacccagtggtgaatttctt |
31209090 |
T |
 |
| Q |
231 |
acatgcttgaataattgaaatatccttttaacgtgtgcgtgtcatttattctcaattaagagaatttgcttttgatgaatgtgcaattctcaaaatgtgg |
330 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31209089 |
acatgcttaaataactgaaatatccttttaacgtgtgtgtgtcatttattctcaa-taagagaatttgcttttgatggatgtgcaattctcaaaatgtgg |
31208991 |
T |
 |
| Q |
331 |
gggttttatgtgaagctgttttgtattt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
31208990 |
gggttttatgtgaagctgttttgtattt |
31208963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 133 - 358
Target Start/End: Original strand, 2690232 - 2690441
Alignment:
| Q |
133 |
caatttcttaagccaaaattttcac-gagaataattaagcttgaaattatctttctctttaaattaaattttggttatgcatctagtggtgaatttctta |
231 |
Q |
| |
|
|||| ||||||||||||| |||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2690232 |
caatctcttaagccaaaactttcactgagaataattacgcttgaaattatctttctctttaaattaaattttggttat----------------ttctta |
2690315 |
T |
 |
| Q |
232 |
catgcttgaataattgaaatatccttttaacgtgtgcgtgtcatttattctcaattaagagaatttgcttttgatgaatgtgcaattctcaaaatgtggg |
331 |
Q |
| |
|
|||||||| |||| | | |||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
2690316 |
catgcttggataacttacatatccttttaacgtgtgtgtgtcatttattctcaat-aagagaatttgcttttgatggatgtgtgattctcaaaatgtggg |
2690414 |
T |
 |
| Q |
332 |
ggttttatgtgaagctgttttgtattt |
358 |
Q |
| |
|
|||||||||||||| |||||||||||| |
|
|
| T |
2690415 |
ggttttatgtgaagttgttttgtattt |
2690441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 40 - 134
Target Start/End: Complemental strand, 4458609 - 4458516
Alignment:
| Q |
40 |
tctatgtactaactagggtagtaactagaactaatcaatca-ctaactatggttggtgtgagcaaatgactaaataaccagttaagttaagtaaca |
134 |
Q |
| |
|
|||||||| ||| | || || |||||||||||||| ||||| ||||| |||||| |||| || |||| |||| |||||||||||||||||||||| |
|
|
| T |
4458609 |
tctatgtagtaatttggatactaactagaactaataaatcaactaacaatggttagtgtaagtaaataacta--taaccagttaagttaagtaaca |
4458516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University