View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16604_low_16 (Length: 347)
Name: NF16604_low_16
Description: NF16604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16604_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 335
Target Start/End: Original strand, 40023053 - 40023387
Alignment:
| Q |
1 |
tgcttaagtgaactgttatgtttcaccgcgatggctagatgtttcttattattacccccattgcaagtgttttccaccggcttctcctccatctcaatac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40023053 |
tgcttaagtgaactgttatgtttcaccgcgatggctagatgtttcttattattacccccattgcaagtgttttccaccggcttctcctccatctcaatac |
40023152 |
T |
 |
| Q |
101 |
ccattcttaagtgtaacttctcacccttacgtggccatggttgtttacatagatcctgata----cttccattttttgttaaagcaatgataaacctaca |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| ||||||||||||| ||||||||| |
|
|
| T |
40023153 |
ccattcttaagtgtaacttctcacccttacatggccatggttgtttacatagatcctgatactcccttccattttcagttaaagcaatgacaaacctaca |
40023252 |
T |
 |
| Q |
197 |
cgatgtccaagcattcattaatgtctcaactagaagcctgattattattagcacacattttggttcatgtgtgtcgtcgtaaccctagctcccctttgtc |
296 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40023253 |
cgatgtccaagcattcattaatgtctcgactagaagcctg---attattaggacacattttggttcatgtgtgtcgtcgtaaccctagctcccctttgtc |
40023349 |
T |
 |
| Q |
297 |
accaaaatatgatcgatggtagcctatgtcatacccttc |
335 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
40023350 |
accaaaata-gatcgatggtagcctatgtcataaccttc |
40023387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University