View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16604_low_33 (Length: 244)
Name: NF16604_low_33
Description: NF16604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16604_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 127 - 228
Target Start/End: Complemental strand, 38695885 - 38695784
Alignment:
| Q |
127 |
ggaccttatcatgatgaactcatcctaaatatcattcgatcaagattgcataagaaaatatggaccatccagttcagaactcttcattgtcttggaacct |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38695885 |
ggaccttatcatgatgaactcatcctaaatatcattcgatcaagattgcataagaaaatatggaccatccagttcagaactcttcattgtcttggaacct |
38695786 |
T |
|
| Q |
227 |
tc |
228 |
Q |
| |
|
|| |
|
|
| T |
38695785 |
tc |
38695784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 38696013 - 38695969
Alignment:
| Q |
1 |
ctacaagtagggaaacctggtctttaaactccgacataaatatat |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38696013 |
ctacaagtagggaaacctggtctttaaactccgacataaatatat |
38695969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University