View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16604_low_34 (Length: 239)
Name: NF16604_low_34
Description: NF16604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16604_low_34 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 15 - 239
Target Start/End: Complemental strand, 50465724 - 50465495
Alignment:
| Q |
15 |
atcacagaatgtaatgcattatgcatgtacataaaagaatggatatgcaactgtgtattacta-------attctttttagccattcacaaacaagtcaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
50465724 |
atcacagaatgtaatgcattatgcatgtacataaaagaatggatatgcaactgtgtattactacttactaattctttttagccattcacaaacaagtcaa |
50465625 |
T |
 |
| Q |
108 |
ctagcacgatcaagtactaactctatacaacattttcaattgtaatcttgattttcttaccccattttctcctctctgttttgctacatcaaatctatta |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
50465624 |
ctagcacgatcaagtactaactctatacaacattttcaattgtaatcttgattttcttaccccattttctcctctctattttgctacatcaaatctatta |
50465525 |
T |
 |
| Q |
208 |
nnnnnnnncttcttatatcactttctttcctt |
239 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
50465524 |
--ttttttcttcttatatcactttctttcctt |
50465495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University