View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16604_low_37 (Length: 228)
Name: NF16604_low_37
Description: NF16604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16604_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 19 - 216
Target Start/End: Original strand, 3458908 - 3459103
Alignment:
| Q |
19 |
tttacagccatccattgatcctagagtggaggtgtcatctctttggaacaaggacgtccctttaaagatagttccgtgtgtgtggcgtctgttttgtgat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
3458908 |
tttacagccatccattgatcctagagtggaggtgtcatctcttcggaacaaggacgtccctttaaagatagtta--tgtgtgtggcgtctgttttatgat |
3459005 |
T |
 |
| Q |
119 |
aggctgcctgcaaaagataatcttcttcgacgaggagttattgataatgattcccgtttgtgtctcagtgggtgtggatttatggaaacttcatctca |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3459006 |
aggctgcctgcaaaagataatcttcttcgacgaggagttattgataatgattcccgtttgtgtgtcagtgggtgtggatttatggaaacttcatctca |
3459103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 101 - 174
Target Start/End: Original strand, 44674743 - 44674816
Alignment:
| Q |
101 |
tggcgtctgttttgtgataggctgcctgcaaaagataatcttcttcgacgaggagttattgataatgattcccg |
174 |
Q |
| |
|
|||| ||||||| | |||||| ||||| |||| |||||||||||||| || |||||||||| ||| |||||||| |
|
|
| T |
44674743 |
tggcatctgtttcgagataggttgcctacaaaggataatcttcttcgtcgtggagttattggtaacgattcccg |
44674816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 116 - 174
Target Start/End: Complemental strand, 25130876 - 25130818
Alignment:
| Q |
116 |
gataggctgcctgcaaaagataatcttcttcgacgaggagttattgataatgattcccg |
174 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||| || ||||||||| ||| ||||||||| |
|
|
| T |
25130876 |
gataggctgcctacaaaggataaccttcttcgtcgtggagttattaatattgattcccg |
25130818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University