View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16606_low_8 (Length: 232)
Name: NF16606_low_8
Description: NF16606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16606_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 24 - 215
Target Start/End: Complemental strand, 10559726 - 10559536
Alignment:
| Q |
24 |
tcactttcgtcgtgctcggtttgaagtgaatggatccgtttttcgtgttggcgatcgcgttcacacgccaaatttcaaatattagattcattttgactca |
123 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10559726 |
tcactttcgtcgtgctcggtttgtggtgaatggatccgtttt-cgtgttggcgatcgcgttcacacgccaaatttcaaatattagattcattttgactca |
10559628 |
T |
|
| Q |
124 |
tcctagtttgttgttgtgatacttgcaatcgctcatgcaccacttttttctttgcaatttgattttgcatccatacacaagtgccctatatt |
215 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10559627 |
tcctagtttgttgttgtcatacttgcaatcgctcatgcaccacttttttttttgcaatttgattttgcatccatacgcaagtgccctatatt |
10559536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University