View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16606_low_9 (Length: 224)
Name: NF16606_low_9
Description: NF16606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16606_low_9 |
 | |
|
| [»] scaffold0007 (1 HSPs) |
| | |
|
| [»] scaffold0012 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0007 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 75670 - 75458
Alignment:
| Q |
1 |
ttttgagattagaattcttttgtcagaacagaatatgagtgagtcacattaactatagatctggcaaagatgaggaatttttatggttttggttggtttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
75670 |
ttttgagattagaattcttttgtcagaacagaatatgagtgagtcacattaactatagatctggcaaagatgaggaatttttatggttttggttggtttt |
75571 |
T |
|
| Q |
101 |
cccaaaagatgaggaattctttgtttgggttgattttataaaagactgaccgatgctctcttttacctgcattacgaaaccaagttacataaagattata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
75570 |
cccaaaagatgaggaattctttgtttgggttgattttataaaagactgaccgatgctctcttttacctgcattacgaaaccaagttacataaagattata |
75471 |
T |
|
| Q |
201 |
cagtccagcctat |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
75470 |
cagtccagcctat |
75458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0012 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0012
Description:
Target: scaffold0012; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 190
Target Start/End: Original strand, 235903 - 235972
Alignment:
| Q |
121 |
ttgtttgggttgattttataaaagactgaccgatgctctcttttacctgcattacgaaaccaagttacat |
190 |
Q |
| |
|
|||||||| ||| |||| |||||| ||||| |||||||||| |||||||||| ||| ||||||||||| |
|
|
| T |
235903 |
ttgtttggattggttttccaaaagagtgaccaatgctctcttctacctgcattgagaagccaagttacat |
235972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University