View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16607_high_15 (Length: 335)
Name: NF16607_high_15
Description: NF16607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16607_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 103 - 298
Target Start/End: Complemental strand, 29471465 - 29471270
Alignment:
| Q |
103 |
ttggtgtaaaagatgttagagcggttaatttgagccccttggctaagtggagacgatggttgcttcaaatgatagtcccctttggaaaaaggttttggtc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29471465 |
ttggtgtaaaagatgttagagcggttaatttgagccccttggctaagtggagacgatggttgcttcaaatgatagtcccctttggaaaaaggttttggtc |
29471366 |
T |
|
| Q |
203 |
ggtaagtatagaaatctgagtagggaatgtgttggatgtaatgtctcatgaccggttttcacatcgaggtgggaaaatatattgtttctttagaag |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29471365 |
ggtaagtatagaaatctgagtagggaatgtgttggatgtaatgtctcatgaccggttttcacatcgaggtggggaaatatattgtttctttagaag |
29471270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 15 - 100
Target Start/End: Complemental strand, 29471987 - 29471902
Alignment:
| Q |
15 |
gaggaaattaatattagaagaggtttaaaacaaggatacccactagctccttttttattctttttggtagcggaaggttttggtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29471987 |
gaggaaattaatattagaagaggtttaaaacaaggatacccactagctccttttttattctttttggtagcggaaggttttggtgg |
29471902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 58 - 100
Target Start/End: Original strand, 4902225 - 4902267
Alignment:
| Q |
58 |
tagctccttttttattctttttggtagcggaaggttttggtgg |
100 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||| |||||||| |
|
|
| T |
4902225 |
tagctccttttttattccttttggtagccgaaggatttggtgg |
4902267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University