View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16607_high_17 (Length: 298)
Name: NF16607_high_17
Description: NF16607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16607_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 44 - 284
Target Start/End: Original strand, 16191011 - 16191251
Alignment:
| Q |
44 |
aagacattggaaccataatttttattgggacttgttaaaatgatttgcacatttgagggtggagttcatcgtgacatgactgagcttggcatgacccgga |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16191011 |
aagacattggaaccataatttttattgggacttgttaaaatgatttgcacatttgagggtggagttcatcgtgacatgactgagcttggcatgacccgga |
16191110 |
T |
 |
| Q |
144 |
caaccaagccgtgctaggcatactaaatgatggagttgatcttagcatgacctaaaaggtcaagcttagctagacatgttgtatattggagctaagcttg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16191111 |
caaccaagccgtgctaggcatactaaatgatggagttgagcttagcatgacctaaaaggtcaagcttagctagacatgttgtatattggagctaagcttg |
16191210 |
T |
 |
| Q |
244 |
tcatgacttgaatgaccaagctgagtttggtatgctagatg |
284 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
16191211 |
tcatgacttgaatgatcaagccgagtttggtatgctagatg |
16191251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University