View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16607_high_21 (Length: 265)
Name: NF16607_high_21
Description: NF16607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16607_high_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 10 - 249
Target Start/End: Original strand, 17327484 - 17327723
Alignment:
| Q |
10 |
gcagagacctctaaaacctttatgatacgcccataattatgattgtggaccgcaatttagaactaagtccctcgactcaagctttcttctccttaactgg |
109 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17327484 |
gcagagacctctaaaacttttatgatacgcccataattatgattgtggaccgcaatttagaacaaagtccctcgactcaagctttcttctccttaactgg |
17327583 |
T |
|
| Q |
110 |
tgacataaatagaaaccgataaaccatagcagcagaactagcaccaattaaaggacatatccaaaaaacataaaattgctcccaagtattgtgcttattg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17327584 |
tgacataaatagaaaccgataaaccatagcagcagaactagcaccaattaaaggacatatccaaaaaacataaaattgctcccaagtattgtgcttattg |
17327683 |
T |
|
| Q |
210 |
ttcatataagcccaaccaaatgcattagcagggttcatag |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17327684 |
ttcatataagcccaaccaaatgcattagcagggttcatag |
17327723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University