View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16607_high_23 (Length: 246)
Name: NF16607_high_23
Description: NF16607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16607_high_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 17 - 230
Target Start/End: Original strand, 49268525 - 49268738
Alignment:
| Q |
17 |
gaagacgagttttagtttcggccatgaacataaaattccataattaaacatgtttgatttggaccaattatgggatgaatggtctatgagaagtttttct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49268525 |
gaagacgagttttagtttcggccatgaacataaaattcaataattaaacatgtttgatttggaccaattatgggatgaatggtctacgagaagtttttct |
49268624 |
T |
|
| Q |
117 |
tataatgtgtaacgggaaaacacattgaaaaaatatattggtaccatagcgcacatcgtctcctagtaagatgtggtgcatgaaggaaccaaatgaggag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49268625 |
tataatgtgtaacgggaaaacacattgaaaaaatatattggtaccatagcgcacatcgtctcctagtaagatgtcgtgcatgaaggaaccaaatgaggag |
49268724 |
T |
|
| Q |
217 |
tagtgagcatgtag |
230 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
49268725 |
tagtgagcatgtag |
49268738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University