View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16607_low_16 (Length: 364)
Name: NF16607_low_16
Description: NF16607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16607_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 80 - 361
Target Start/End: Original strand, 7499040 - 7499321
Alignment:
| Q |
80 |
gaaaggcatcaatgttggggccacattggaatccaatggcaacagaagtagcagtggtgttggaaggggaaggaatggtaagagtggtatgtggaagcaa |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7499040 |
gaaaggcatcaatgttggggccacattggaatccaatggcaacagaagtagcagtggtgttggaaggggaaggaatggtaagagtggtatgtggaagcaa |
7499139 |
T |
|
| Q |
180 |
caatgatgacaaatgcaaaaacaagaggtttagagttcagcaaggagatgtttttgtggtgcctaggtttcatccaatggctcaaatgtcatttgttaat |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7499140 |
caatgatgacaaatgcaaaaacaagaggtttagagttcagcaaggagatgtttttgtggtgcctaggtttcatccaatggctcaaatgtcatttgttaat |
7499239 |
T |
|
| Q |
280 |
cagacacttgtttttatgggattcagcactgctgcaaagaaaaatcatcctcagtttttggctggtaaagaatctgtgctgc |
361 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7499240 |
cagccacttgtttttatgggattcagcactgctgcaaagaaaaatcatcctcagtttttggctggtaaagaatctgtgctgc |
7499321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University