View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16607_low_28 (Length: 238)
Name: NF16607_low_28
Description: NF16607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16607_low_28 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 19146444 - 19146664
Alignment:
| Q |
17 |
atggttatcttatctttgaaaaagagatcaaaccgcaaaaagagaccaacacaattcaaatggaggcgtcttcaactgaagaaatccaaatcttccagga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19146444 |
atggttatcttatctttgaaaaagagatcaaaccgcaaaaagagaccaacacaattcaaatggaggcgtcttcaactgaagaaatccaaatcttccagga |
19146543 |
T |
|
| Q |
117 |
gaaggagaatatcttaaagctccatttacatgagggaaataaggagaggaaccaaaaagagatgatattgaccttttctttctttgttctttcgagaatg |
216 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19146544 |
gaaggagattatcttaaagctccatttacatgagggaaataaggagagaaacc-aaaagagatgatattgaccttttctttctttgttctttcgagaatg |
19146642 |
T |
|
| Q |
217 |
ttgtcgagaagataaaagacct |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
19146643 |
ttgtcgagaagataaaagacct |
19146664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University