View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16607_low_32 (Length: 218)
Name: NF16607_low_32
Description: NF16607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16607_low_32 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 819553 - 819776
Alignment:
| Q |
1 |
ttttcatttctctctttcttctcagtctcgtacgtacttactgctactattgc----tctcatattattcaattattcnnnnnnnnnnnnnngtta--ta |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || || |
|
|
| T |
819553 |
ttttcatttctctctttcttctcagtctcgtacgtacttactgctactattgcatgctctcatattattcaattattcttttttttttttttttttgtta |
819652 |
T |
 |
| Q |
95 |
tatattaagattcaataatcaccaccaccttgtttctctctactagcaaattgtttgttttgttccaaatccattttattattactactagagtatttgt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
819653 |
tatattaagattcaataatcaccaccaccttgtttctctctactagcaaattgtttgttttgttccaaatccattttattattactactagagtatttgt |
819752 |
T |
 |
| Q |
195 |
ggtggtgttctctggattagtttt |
218 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
819753 |
ggtggtgttctctggattagtttt |
819776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University