View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16610_low_5 (Length: 309)
Name: NF16610_low_5
Description: NF16610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16610_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 16 - 291
Target Start/End: Original strand, 13663118 - 13663391
Alignment:
| Q |
16 |
tatactattgctagaattctaacctgtaaatgagaaattcaacagaagaataaaacagtaaacatgaacatcaattctagagtnnnnnnnnnnnnnnnnn |
115 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13663118 |
tatactattgcaagaattctaacctttaaatgagaaattcaacagaagaataaaacagtaaacatgaacatcaatcctagagtaaaaaaaataaaaaaa- |
13663216 |
T |
|
| Q |
116 |
ntcattccaacaagaaatgtaaatttacactaatgtagtttatatatgaatacatgatatttctcatgattcttaataatcgtagacaaactttcaattg |
215 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
13663217 |
-tcattctaacaaaaaatgtaaatttacactaatgtagtttatatatgaataaatgatatttctcatgattcctaataacagtagacaaactttcaattg |
13663315 |
T |
|
| Q |
216 |
ctttgtatcatattatccaactgctttattattagattttaacgatatggaacaaatccattatagttgcataact |
291 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13663316 |
ctttatatcatattatccaactgctttattattagatcttaacgatatggaacaaatccattatagttgcataact |
13663391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University