View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16611_low_11 (Length: 435)
Name: NF16611_low_11
Description: NF16611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16611_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 372; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 372; E-Value: 0
Query Start/End: Original strand, 1 - 416
Target Start/End: Complemental strand, 26933300 - 26932884
Alignment:
| Q |
1 |
aattcagagattgggagaatggcattatcaacatccatagttagtgatgcatgtatgtgggtagtttattttatagtaatcaatggaactttagccttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26933300 |
aattcagagattgggagaatggcattatcaacatccatagttagtgatgcatgtatgtgggtagtttattttatagtaatcaatggaactttagccttgg |
26933201 |
T |
 |
| Q |
101 |
aacgtaaatcatataaatttcttctaaaaatctctatgacaattggttatttcgccgtcttannnnnnn-gttaaggccattagttatatggatctcgaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26933200 |
aacgtaaatcatataaatttcttctagaaatgtctatgacaattggttatttcgccgtcttatattttttgttaaggccattagttatatggatctcgaa |
26933101 |
T |
 |
| Q |
200 |
ccgcaatccaaaggaaaagccgatgacggaaagccatttcttgatgataattggtatacttttgatagttggactctccgcacaaattgcgggacaatct |
299 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26933100 |
ccgcaatccaaagggaaagtcgatgacggaaagccatttcttgatgataattggtatacttttgatagttggactctccgcacaaattgcgggacaatct |
26933001 |
T |
 |
| Q |
300 |
tcttttatcattgcgttttggtttggtttgtttttgccggatggtcctcctttaggttctattttgagtgaaagacttggtactattggttctactttga |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26933000 |
tcttttatcattgcgttttggtttggtttgtttttgccggatggtcctcctttaggttctattttgagtgaaagacttggtactattggttctactttga |
26932901 |
T |
 |
| Q |
400 |
ctgttccagcttattgt |
416 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
26932900 |
ctgttccagcttattgt |
26932884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University