View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16611_low_22 (Length: 276)
Name: NF16611_low_22
Description: NF16611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16611_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 16 - 259
Target Start/End: Original strand, 47271743 - 47271995
Alignment:
| Q |
16 |
caaaaacaagggaatccgtgtctgatgttaagagataacatatcaaacgttgtttgttgttctagtattttcagcttgattttcatgtccaagggccaga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47271743 |
caaaaacaagggaatccgtgtctgatgttaagagataacatatcaaacgttgtttgttgttctagtattttcagcttgattttcatgtccaagggccaga |
47271842 |
T |
 |
| Q |
116 |
accttattta-tacttggagttattaaaattgattcaagtggtttgatatctcctaatagctatttttcttttatatcatct---agcattaacaataga |
211 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
47271843 |
accttatttattacttggagttattaaaattgattcaagtggtttgatatctcctaatagctatttttcttttatatcatctagcagcattaacaataga |
47271942 |
T |
 |
| Q |
212 |
ctacacctaaagaaatgcag-----ttatatgtaatctcttacaccgcttcat |
259 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47271943 |
ctacacctaaagaaatgcagttatattatatgtaatctcttacaccgcttcat |
47271995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University