View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16611_low_26 (Length: 256)
Name: NF16611_low_26
Description: NF16611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16611_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 36582660 - 36582898
Alignment:
| Q |
1 |
tcatcaaaaaagagagtgatcacttgaacaacaaaatctggannnnnnncatcttgaagttgctcaagctggttgaattgatcatctagaaacccctttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36582660 |
tcatcaaaaaagagagtgatcacttgaacaacaaaatctggatttttttcatcttgaagttgctcaagctggttgaattgatcatctagaaacccctttt |
36582759 |
T |
 |
| Q |
101 |
caatcaaagacaaaaggaaaataatagtactagtgagtaatacaagaaattaacatagcttaattatgaggcttttgtctctactacactgtaatgtaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36582760 |
caatcaaagacaaaaggaaaataatagtactagtgagtaatacaagaaattaacatagcttaattatgaggcttttgtctctactacactgtaatgtaat |
36582859 |
T |
 |
| Q |
201 |
gcaaattgtacttgagcagaatatgattaagttaattac |
239 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36582860 |
gcaaattgtacttaagcagaatatgattaagttaattac |
36582898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 50 - 103
Target Start/End: Complemental strand, 47027401 - 47027348
Alignment:
| Q |
50 |
catcttgaagttgctcaagctggttgaattgatcatctagaaaccccttttcaa |
103 |
Q |
| |
|
||||||||||| | | ||||||||| |||||||||||||| || |||||||||| |
|
|
| T |
47027401 |
catcttgaagtagttgaagctggttaaattgatcatctaggaatcccttttcaa |
47027348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University