View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16612_high_23 (Length: 238)
Name: NF16612_high_23
Description: NF16612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16612_high_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 14 - 236
Target Start/End: Complemental strand, 32159443 - 32159210
Alignment:
| Q |
14 |
tattctatttggcattggcatttgattgatgtttttgtttacttttctcatgatcttgttactcttcctcctgtttgttggattaataccgctcattgcc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32159443 |
tattctatttggcattggcatttgattgatgtttttgtttacttttctcatgatcttgttactcttcctcctgtttgttggattaataccgctcatcgcc |
32159344 |
T |
 |
| Q |
114 |
acggtgtcaaggtactaacttgcttacttgcttcgagtc----------tagttgaattggttttagttcagctcatttgg-ttaataaatcaaattcaa |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
32159343 |
acggtgtcaaggtactaacttgcttacttgcttcgagtcgagttgaatttggttgaattggttttagttcagctcatttggtttgataaatcaaattcaa |
32159244 |
T |
 |
| Q |
203 |
tacgttattttgttgaattgagtttcgaactaac |
236 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
32159243 |
tacgttattttgttgaattgagtttccaactaac |
32159210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University