View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16612_high_24 (Length: 229)
Name: NF16612_high_24
Description: NF16612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16612_high_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 48 - 212
Target Start/End: Complemental strand, 42336153 - 42335989
Alignment:
| Q |
48 |
agggaagaatatatatgactatattatgttgttatagtacaactcaaagtctgcacttttcttgtcaaacaaataaatattccatgcacctcataacaag |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42336153 |
agggaagaatatatatgactatattatgttgttatagtacaactcaaagtctgcacttttcttgtcaaacaaataaatattccatgcacctcataacaag |
42336054 |
T |
|
| Q |
148 |
ttgcccctttaaaatcccggtcattgaaaattgaaaccatataaatcaatggctaatattgaatt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42336053 |
ttgcccctttaaaatcccggtcattgaaaattgaaaccatataaatcaatggctaatattgaatt |
42335989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University