View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16612_low_14 (Length: 328)
Name: NF16612_low_14
Description: NF16612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16612_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 11 - 313
Target Start/End: Complemental strand, 44456220 - 44455924
Alignment:
| Q |
11 |
cacagagggaatgaaaatcatggttacagtttggaagcgtacggcattcatcaccgtcggtgaactccgacaagcagacagcgcagtcatggagagtacg |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44456220 |
cacacagggaatgaaaatcatggttacagtttggaagcgtaaggcattcatcaccgtcggtgaactccgacaagcagacagcgcagtcatggagagtacg |
44456121 |
T |
 |
| Q |
111 |
accggttgcnnnnnnnnnnnnnnnnnnnnnntaagtaaatgttggaagcgattttagaacggaagggtcaaggcgttcttctttgaaagtggtggttgta |
210 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44456120 |
accggttgcggaggaggaggaggag------taagtaaatgttggaagcgactttagaacggaagggtcaaggcgttcttctttgaaagtggtggttgta |
44456027 |
T |
 |
| Q |
211 |
acagaatcttgagagaatagacgacggctgcgaaggtggcagatgtaaacgtaagtgcgaaagagaaggatgatgagtatgagtatgaagagaaggatgg |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44456026 |
acagaatcttgagagaatagacgacggctgcgaaggtggcagatgtaaacgtaagtgcgaaagagaaggatgatgagtatgagtatgaagagaaggatgg |
44455927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University