View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16612_low_15 (Length: 324)
Name: NF16612_low_15
Description: NF16612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16612_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 11 - 305
Target Start/End: Complemental strand, 43092618 - 43092316
Alignment:
| Q |
11 |
ttattcttagcttaagtattttttgactggtgtaacttagttggtggtaaaagatttata-----------tgaacactttatattccgagtgctagttt |
99 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43092618 |
ttattcttagcttaagtattttttagcaggtgtaacttaggtggtggtaaaagatttatacgaacactttatgaacactttatattccgagtgctagttt |
43092519 |
T |
 |
| Q |
100 |
gactccgtaatacccttcttccatgtattagtgccggttttgccgctaaactcttcaaaaacnnnnnnnngctgaattatattttaggccttgcaaaata |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43092518 |
gactccgtaatacccttcttccatgtattagtgccggttttgccgttaaactcttaaaaaatatttttttgctgaattatattttaggccttgcaaaata |
43092419 |
T |
 |
| Q |
200 |
aattactttgattttaatccctaaaacttccaaaacaattaactagggtgttcaaaacacgatccagtcttgcaatccgttcttcttatgatttgggtct |
299 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43092418 |
aattactttgattttaatccctaaaactcccaaaacaattaactagggtgttcaaaacacgatccagtcttgcaatccgt---tcttatgatttgggtct |
43092322 |
T |
 |
| Q |
300 |
aatccg |
305 |
Q |
| |
|
|||||| |
|
|
| T |
43092321 |
aatccg |
43092316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University