View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16612_low_26 (Length: 233)
Name: NF16612_low_26
Description: NF16612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16612_low_26 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 113 - 217
Target Start/End: Original strand, 44855095 - 44855199
Alignment:
| Q |
113 |
ttaatatattccatgtattgaacattttggcaccaacaaacgttttctcttgttttttattatttacaaaaatgtggtttgttttcaatttaataaaatc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44855095 |
ttaatatattccatgtattgaacattttggcaccaacaaacgttttctcttgttttttattatttacaaaaatgtggtttgttttcaatttaataaaatc |
44855194 |
T |
|
| Q |
213 |
atatt |
217 |
Q |
| |
|
||||| |
|
|
| T |
44855195 |
atatt |
44855199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University