View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16612_low_27 (Length: 229)

Name: NF16612_low_27
Description: NF16612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16612_low_27
NF16612_low_27
[»] chr4 (1 HSPs)
chr4 (48-212)||(42335989-42336153)


Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 48 - 212
Target Start/End: Complemental strand, 42336153 - 42335989
Alignment:
48 agggaagaatatatatgactatattatgttgttatagtacaactcaaagtctgcacttttcttgtcaaacaaataaatattccatgcacctcataacaag 147  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42336153 agggaagaatatatatgactatattatgttgttatagtacaactcaaagtctgcacttttcttgtcaaacaaataaatattccatgcacctcataacaag 42336054  T
148 ttgcccctttaaaatcccggtcattgaaaattgaaaccatataaatcaatggctaatattgaatt 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42336053 ttgcccctttaaaatcccggtcattgaaaattgaaaccatataaatcaatggctaatattgaatt 42335989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University