View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16613_low_3 (Length: 270)
Name: NF16613_low_3
Description: NF16613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16613_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 12 - 254
Target Start/End: Original strand, 2670112 - 2670354
Alignment:
| Q |
12 |
caaagggtgtttagaagtggttcatggaatggtcaatcttttggtggagtaccaatactaagcacaatagctgctcttaatgataaaatagttgttgatg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2670112 |
caaagggtgtttagaagtggttcatggaatggtcaatcttttggtggagtaccaatactaagcacaatagctgctcttaatgataaaatagttgttgatg |
2670211 |
T |
 |
| Q |
112 |
aacatgaagcttattattatcctgcagggttgttgcagtctaatttatctagacttgttgtgaattcgaccggttcaatggaacgttatgcatggatcga |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2670212 |
aacatgaagcttattattatcctgcagggttgttgcagtctaatttatctagacttgttgtgaattcgaccagttcaatggaacgttatgcatggatcga |
2670311 |
T |
 |
| Q |
212 |
aagcactaaagattggaacaaagtatggtctgcaccagttctt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2670312 |
aagcactaaagattggaacaaagtatggtctgcaccagctctt |
2670354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University