View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16613_low_4 (Length: 258)
Name: NF16613_low_4
Description: NF16613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16613_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 9 - 244
Target Start/End: Original strand, 38898967 - 38899202
Alignment:
| Q |
9 |
gagatgaactatggactgaagtaattgtgaggaactagagatggctctagctatgaagggtnnnnnnngtccatgttgagatgcaaaagctatcttacaa |
108 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38898967 |
gagatgaactgtggactgaagtaattgtgaggaactagagatggctctagctatgaagggtaaaaaaagtccatgttgagatgcaaaagctatcttacaa |
38899066 |
T |
 |
| Q |
109 |
acccagtttactacaatggttgcatatatgcagagtcatttggaagnnnnnnnagtagtaatctagaaacatggttgccaaggacttaaaataaaccaca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38899067 |
acccagtttactacaatggttgcatatatgcagagtcattgggaagtttttttagtagtaatctagaaacatggttgccaaggacttaaaataaaccaca |
38899166 |
T |
 |
| Q |
209 |
tacttgttctcatgccaacacttccaccaactagat |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
38899167 |
tacttgttctcatgccaacacttccaccaactagat |
38899202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University