View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16614_low_3 (Length: 233)
Name: NF16614_low_3
Description: NF16614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16614_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 214
Target Start/End: Complemental strand, 40675857 - 40675661
Alignment:
| Q |
18 |
cactatttgcttgcaatctgtttctagctcaacatgaaactcctctttgccttgtaaccatgtcagagtttgcagctcaatgtgcaacttctctttgccg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40675857 |
cactatttgcttgcaatctgtttctagctcaacatgaaactcctctttgccttgtaaccatgtcagagtttgcagctcaatgtgcaacttctctttgccg |
40675758 |
T |
 |
| Q |
118 |
tgtaaccatatcagagtcttcattaaactgtttgcttcagcttcacatggcgaaggtgttcctacaaaccacgtattccgtgcttggaccataactc |
214 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40675757 |
tgtaaccatatcagagtctgccttaaactgtttgcttcagcttcacatggcgaaggtgttcctacaaaccacatattccgtgcttggaccataactc |
40675661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 153 - 214
Target Start/End: Complemental strand, 40684682 - 40684621
Alignment:
| Q |
153 |
ttcagcttcacatggcgaaggtgttcctacaaaccacgtattccgtgcttggaccataactc |
214 |
Q |
| |
|
||||||||| | ||||||||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
40684682 |
ttcagcttcgcttggcgaaggtgttcctataaaccacccagtccgtgcttggaccataactc |
40684621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University