View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16615_high_8 (Length: 286)
Name: NF16615_high_8
Description: NF16615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16615_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 20 - 276
Target Start/End: Complemental strand, 29406808 - 29406552
Alignment:
| Q |
20 |
taagatacatggataaagaggaatccccacaaatccccagaagaacgactaggtctttatctacgccatccacttcaaatattgtacctgcggcaaaagt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29406808 |
taagatacatggataaagaggaatccccacaaatccccagaagaacgactaggtctttatctacgccatccacttcaaatattgtacctgcggcaaaagt |
29406709 |
T |
 |
| Q |
120 |
aaacagcagccttgaatccctaacaattaacgaccttttagttggaggagaccctgttagccttgatgatataatttccagttttcctggaagaagtagt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29406708 |
aaacagcagccttgaatccctaacaattaacgaccttttagttggaggagaccctgttagccttgatgatataatttccagttttcctggaagaagtagt |
29406609 |
T |
 |
| Q |
220 |
caaattcgtgagattttgcgtcttttgggaccgttgaattcgccattacttcctttg |
276 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29406608 |
caaattcatgagattgtgcgtcttttgggaccgttgaattcgccattacttcctttg |
29406552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University