View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16615_low_13 (Length: 250)
Name: NF16615_low_13
Description: NF16615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16615_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 231
Target Start/End: Original strand, 9101935 - 9102150
Alignment:
| Q |
16 |
acagaacatcttaatcaaaagtagtagtcatgacaatggtctttactgcaaatttgcgttcattcttcaactctatccatggttggaatctttgaaacga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9101935 |
acagaacatcttaatcaaaagtagtagtcatgacaatggtcttcactgcaaatttgcgttcattcttcaactctatccatggttggaatctttgaaacga |
9102034 |
T |
 |
| Q |
116 |
tattgccatgaattggggggaaggtgttctttaaactttaactttttagttgcctagctgcatgaaaagctcatgattgagactcaataatagcttatca |
215 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9102035 |
tattgccatgaattggggggaaggtattctttaaactttaactttttagttgcctagctgcatgaaaagctcgtgattgagactcaataatagcttatca |
9102134 |
T |
 |
| Q |
216 |
tttaaccagacgatcc |
231 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
9102135 |
ttcaaccagacgatcc |
9102150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University