View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16615_low_8 (Length: 288)
Name: NF16615_low_8
Description: NF16615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16615_low_8 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 176 - 288
Target Start/End: Complemental strand, 31583950 - 31583838
Alignment:
| Q |
176 |
catcattcaacatcaaattagtaaaatctatgtttaggtaatcctaacttatttctatgaaaatccttcgtaataacatttggaagattgccctaccgag |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31583950 |
catcattcaacatcaaattagtaaaatctatgtttaggtaatcctaacttatttctatgaaaatccttcgtaataacatttggaagattgccctaccgag |
31583851 |
T |
 |
| Q |
276 |
tgaaactaataac |
288 |
Q |
| |
|
||||||||||||| |
|
|
| T |
31583850 |
tgaaactaataac |
31583838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 16 - 119
Target Start/End: Complemental strand, 31584110 - 31584007
Alignment:
| Q |
16 |
atcattaataaaagtaaaaaatgcacaaacttagatgaactaaaccaaacccaaagcaatacacaaggtgaatgctaatctctacttcattagaaacctt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31584110 |
atcattaataaaagtaaaaaatgcacaaacttagatgaactaaaccaaacccaaagcaatacacaaggtgaatgctaatctctacttcattagaaacctt |
31584011 |
T |
 |
| Q |
116 |
cccc |
119 |
Q |
| |
|
|||| |
|
|
| T |
31584010 |
cccc |
31584007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University