View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16616_high_5 (Length: 255)
Name: NF16616_high_5
Description: NF16616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16616_high_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 7e-98; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 30958937 - 30959177
Alignment:
| Q |
1 |
aatctcccaatgttgctttctatagtgttggtaatgaagataggttgttggaagaatcaaggaattgtatgagtcatattcaagtgccagtaggaacaga |
100 |
Q |
| |
|
||||||| ||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
30958937 |
aatctccgaatcatgctttctttagtgttggtaatgaagataggttgttggaagaatcaaggaattgtatgagtcatattcatgtgccagtaggagcaga |
30959036 |
T |
 |
| Q |
101 |
ttttccttttgggaaagattatgatgattattttgatcatgattttcttgaaaatggtttggataaggggtttgagttgaattatattctgaaagaggaa |
200 |
Q |
| |
|
||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
30959037 |
ttttcctggtgtgaaagattatgttgattattttgatcatgattttcttgaaaatggtttggataaggggtttgagttgaattatactatgaaagaggaa |
30959136 |
T |
 |
| Q |
201 |
tgcataaggtgtttgggaaatgaaggaggagattgtaaatg |
241 |
Q |
| |
|
||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30959137 |
tgctcaaggtgtttgggaagtgaaggaggagattgtaaatg |
30959177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 146 - 241
Target Start/End: Original strand, 31012899 - 31012994
Alignment:
| Q |
146 |
tcttgaaaatggtttggataaggggtttgagttgaattatattctgaaagaggaatgcataaggtgtttgggaaatgaaggaggagattgtaaatg |
241 |
Q |
| |
|
|||| ||| ||||||| |||| ||||||||| ||||||||| | ||||||||||||| || ||||||||||| ||||| ||||||||||||||| |
|
|
| T |
31012899 |
tcttaaaagtggtttgaataatgggtttgaggtgaattatagtgtgaaagaggaatgtgcaaagtgtttgggaagtgaagaaggagattgtaaatg |
31012994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University