View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16618_high_17 (Length: 344)
Name: NF16618_high_17
Description: NF16618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16618_high_17 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 1 - 344
Target Start/End: Complemental strand, 13308912 - 13308569
Alignment:
| Q |
1 |
tgcgtagtttctgttttgctgtctatgatccttgcatgtctaacaatatggaagcgtgaaagttcaagaaatctcacatttgacaacggagaaaatcaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
13308912 |
tgcgtagtttctgttttgctgtctatgatccttgcatgtctaacaatatggaagcgtgaaagttcaaggaatctcacatttgacaacggagaaaaccaga |
13308813 |
T |
 |
| Q |
101 |
gtactttgtgtggcgatgaagcgtggaagccatgccttaaggacattcaccctgtttgtttgctcgcttttcgagttatctcattctcttctcttttggc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
13308812 |
gtactttgtgtggcgatgaagcgtggaagccatgccttaaggacattcaccctgtttgtttgctagtttttcgagttatctcattctcttctcttttggc |
13308713 |
T |
 |
| Q |
201 |
atcactaattgccaaaatccatgtcagtcatggcacaacattttactattacactcagtgagtatttctcttttgttatcctcatgtacttgatttattt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13308712 |
atcactaattgccaaaatccatgtcagtcatggcacaacattttactattacactcagtgagtatttctcttttgttatcctcatgtacttgatttattt |
13308613 |
T |
 |
| Q |
301 |
atgggtcttgtcatgcttagtgcggtgccatagatttggtgagc |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13308612 |
atgggtcttgtcatgcttagtgcggtgccatagatttggtgagc |
13308569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University