View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16618_high_31 (Length: 248)
Name: NF16618_high_31
Description: NF16618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16618_high_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 2145167 - 2144936
Alignment:
| Q |
1 |
ttctcaattttttgaaaaatatatattggagttatgccctaccaaagtgaatgctgccatgacatgcttcaaatagcacgtacaaggaaattaaaaataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2145167 |
ttctcaattttttgaaaaatatatattggagttatgccctaccaaagtgaaagctgccatgacatgcttcaaatagcacgtacaaggaaattaaaaataa |
2145068 |
T |
|
| Q |
101 |
gtcaattatggaagaagaagggaaattcagcaatattaatgatgaccaacgtggagaacttttgaaacaaaatcagaattcttggtatattcccttctct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2145067 |
gtcaattatggaagaagaagggaaattcagcaatattaatgatgaccaacgtggagaacttttgaaacaaaatcagaattcttggtatattccct--tct |
2144970 |
T |
|
| Q |
201 |
ccattgatcctttttgcaatatggcaaaatattg |
234 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
2144969 |
ccattgatcctttttgcaatatggcaacatattg |
2144936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University