View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16618_high_4 (Length: 559)
Name: NF16618_high_4
Description: NF16618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16618_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 2e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 2e-75
Query Start/End: Original strand, 330 - 532
Target Start/End: Complemental strand, 1237637 - 1237435
Alignment:
| Q |
330 |
aaaaagatcgaccaactgtatcgttccaaggaccaaactgtacaattgatagctaataataatatgataagcattggggcatgtcatgatgttttgaaca |
429 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1237637 |
aaaaagatcgaccaactgtatcgttccaaggaccaaactgtacaattgatagctaata------tgataagcattgggg-atgtcatgatgttttgaaca |
1237545 |
T |
|
| Q |
430 |
tgttgctgctaat---tgctcttgtatttgatcctag----gtacaaagttagatatattaagtactcctgctgattgattaagaatgcttgttctgtat |
522 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1237544 |
tgttgctgctaataattgctcttgtatttgatcctagctaggtacaaagttagatatattaagtactcctgctgattgattaagaatgcttcttctgtat |
1237445 |
T |
|
| Q |
523 |
ttggttttta |
532 |
Q |
| |
|
|||||||||| |
|
|
| T |
1237444 |
ttggttttta |
1237435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University