View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16618_low_31 (Length: 263)
Name: NF16618_low_31
Description: NF16618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16618_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 9784332 - 9784576
Alignment:
| Q |
1 |
gaaaacaacttcacatggaaataggattcatcccatccccagatctaaaagactattgcacttttgccctaaaaaggggatccattgtaaatacaaagaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9784332 |
gaaaacaacttcacatggaaataggattcatcccatccccagatctagaagactattgcacttttgccctaaaaaggggatccattgtaaacacaaagaa |
9784431 |
T |
 |
| Q |
101 |
gataaatcaacccaaaaccatattaaatatttattgccatcttagagtggttcatggaaatctaccatataacatttaaggtgatgttgttttagatttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9784432 |
gataaatcaacccaaaaccatattaaatatttattgccatcttagagtggttcatggaaatcaaccatataacatttaaggtgatgtttttttagatttg |
9784531 |
T |
 |
| Q |
201 |
attttcagttcagtcggcatcgctgttgtagacattggatcaaac |
245 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9784532 |
attttcagttcagtcaacatcgctgttgtagacattggatcaaac |
9784576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University