View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16618_low_35 (Length: 248)

Name: NF16618_low_35
Description: NF16618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16618_low_35
NF16618_low_35
[»] chr1 (1 HSPs)
chr1 (1-234)||(2144936-2145167)


Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 2145167 - 2144936
Alignment:
1 ttctcaattttttgaaaaatatatattggagttatgccctaccaaagtgaatgctgccatgacatgcttcaaatagcacgtacaaggaaattaaaaataa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
2145167 ttctcaattttttgaaaaatatatattggagttatgccctaccaaagtgaaagctgccatgacatgcttcaaatagcacgtacaaggaaattaaaaataa 2145068  T
101 gtcaattatggaagaagaagggaaattcagcaatattaatgatgaccaacgtggagaacttttgaaacaaaatcagaattcttggtatattcccttctct 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||    
2145067 gtcaattatggaagaagaagggaaattcagcaatattaatgatgaccaacgtggagaacttttgaaacaaaatcagaattcttggtatattccct--tct 2144970  T
201 ccattgatcctttttgcaatatggcaaaatattg 234  Q
    ||||||||||||||||||||||||||| ||||||    
2144969 ccattgatcctttttgcaatatggcaacatattg 2144936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University