View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16618_low_41 (Length: 228)
Name: NF16618_low_41
Description: NF16618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16618_low_41 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 27 - 210
Target Start/End: Original strand, 42680535 - 42680717
Alignment:
| Q |
27 |
caatgtatttctaattcttcttttaatctttttgcttaactatttcatttgcagaacgaaacatgcagcaggaaatgtgagtcaaacttctgttcaggta |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42680535 |
caatgtatttctaattcttcttttaatctttttgcctaactatttcatttgcagaacgaaacatgcagcaggaaatgtgagtcaaacttctgttcaggtg |
42680634 |
T |
|
| Q |
127 |
caattttatatatagtttattggattaagtttaannnnnnnnnacgatgtatctatgttgttgatgaacaaaaatgtactaagt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42680635 |
caattttatatatagtttattggattaagtttaa-ttttttttatgatgtatctatgttgttgatgaacaaaaatgtactaagt |
42680717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University