View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16618_low_42 (Length: 227)
Name: NF16618_low_42
Description: NF16618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16618_low_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 38249700 - 38249491
Alignment:
| Q |
1 |
aggtacattttctatataaaaatacttcgaatagtagctagttttctcgtcaaacaaagctcaactctgccatttccaaactatctttctgaggaacgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38249700 |
aggtacattttctatataaaaatacttcgaatagtagctagttttctcgtcaaacaaagctcaactctgccatttccaaactatctttctgaggaacgca |
38249601 |
T |
 |
| Q |
101 |
actcaagccattccatcttctcttctgcatgcttttgctccgtattgattgtgttcaaactatgttttttcatgcatatttgtgtagtttatcttgccct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38249600 |
actcaagccattccatcttctcttctgcatgcttttgctccgtattgattgtgttcaaactatgttttttcatgcatatttgtgtagtttatcttgcctt |
38249501 |
T |
 |
| Q |
201 |
ttttaatatt |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
38249500 |
ttttaatatt |
38249491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 73 - 124
Target Start/End: Complemental strand, 18559900 - 18559846
Alignment:
| Q |
73 |
tttccaaactatctttct---gaggaacgcaactcaagccattccatcttctctt |
124 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||| ||||||||||| |
|
|
| T |
18559900 |
tttccaaactatctttcttctgaggtacgcaactcaagccatttcatcttctctt |
18559846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University