View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16618_low_47 (Length: 210)
Name: NF16618_low_47
Description: NF16618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16618_low_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 20 - 200
Target Start/End: Original strand, 56278993 - 56279171
Alignment:
| Q |
20 |
tcacccaacataactactgaactgatcataactctgccataatgcaaaatgattcagcagtataattggcacatccatcttattgaatccaagaccagca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56278993 |
tcacccaacataactactgaactgatcataactctgccataatgcaaaatgattcagcagtataattggcacatccatcttattgaatccaagaccagca |
56279092 |
T |
 |
| Q |
120 |
cataataattttatgcgcatcccttcaacatacataaatcagttgtac--ttggtttctattatctatgctgtctctgctcct |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||| |||| |
|
|
| T |
56279093 |
cataataattttatgcgcatcccttca----acataaatcagttgtacaattggtttctattatctatgctgtgtctggtcct |
56279171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 55 - 91
Target Start/End: Original strand, 46571673 - 46571709
Alignment:
| Q |
55 |
gccataatgcaaaatgattcagcagtataattggcac |
91 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
46571673 |
gccataatgcaaaatgattcagcactataattggcac |
46571709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University