View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16619_high_3 (Length: 227)
Name: NF16619_high_3
Description: NF16619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16619_high_3 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 38 - 227
Target Start/End: Original strand, 32142916 - 32143105
Alignment:
| Q |
38 |
caaccctacgacatcgttccaaaatatgcctcttctcttcaattagccctccaatttttcgacgtccaaaaatgtaacataatctaatctcgtctattct |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32142916 |
caaccctacgacatcgttccaaaatatgcctcttctcttcaattagccctccaatttttcgacgtccaaaaatgtaacataatctaatctcgtctattct |
32143015 |
T |
|
| Q |
138 |
tagataccgtttagattgacttgcattaacacttatcgaactctttgagagagacatgttcataaacagatttcagaatagtttatgaaa |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
32143016 |
tagataccgtttagattgacttgcattaacacttatcgaactctttgagagagacatgttcataaacagttttcaggatagtttatgaaa |
32143105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University